Skip to main content

Table 2 Eurofins MWG-Operon primer sequences

From: Axonal transport in a peripheral diabetic neuropathy model: sex-dimorphic features

Gene Forward Reverse
36B4 GGATGACTACCCAAAATGCTTC TGGTGTTCTTGCCCATCAG
KIF5A AGGTGCTGAATGGACTGATG ACCTCTGACTTGATCTTGCTG
KIF5B GAATCTGTGGACTCCCTTGG GTTTCTCTGTGACTCTGGATCTG
Dync1i1 ACCCCTATGTCTCCCTCTTC CTTCTCCCAAGTTCTGAGTCTG
MyoVa GATAGAAGGAGTGGACGATGC GAGACGCAAACCCAACATTG
PGC-1α TGAGGAATGCACCGTAAATC GTACAGCTCGAAGTCAGTTTC
mt-Cox II ATTGTATTCCTCATCAGCTCCC TGACAGCTGGGAGAATTGTTC
\