Skip to main content

Table 1 Nucleotide sequence of primers used in qPCR

From: Characterisation of cardiac health in the reduced uterine perfusion pressure model and a 3D cardiac spheroid model, of preeclampsia

Name of primers Sequence (5′-3′)
β-actin (sense) AAGACCTCTATGCCAACAC
β-actin (antisense) TGATCTTCATGGTGCTAGG
Fkbpl (sense) TGGCCTCTCAGGTCTGAACTA
Fkbpl (antisense) TGGGGACTGCTGCTTAATCG
Icam1 (sense) ATGTGCTATATGGTCCTCAC
Icam1 (antisense) GTTTGACAGACTTCACCATC
Vcam1 (sense) CTGATTATCCAAGGCTCTTC
Vcam1 (antisense) CCATTAACAGACTTTAGCACC
Flt1 (sense) CCAGAAGTCGTATGGTTAAAAG
Flt1 (antisense) GCTGTGAGGTTTCTAAATAGC
Vegfa (sense) GATAGAGTATATCTTCAAGCCG
Vegfa (antisense) CTCATCTCTCCTATGTGCTG