Skip to main content

Table 1 Gene primers for RT-PCR

From: Hypogonadal hypertension in male Sprague-Dawley rats is renin-angiotensin system-dependent: role of endogenous androgens

Gene Sequence
Angiotensinogen (Agt) Sense: AGCACGGACAGCACCCTATT
Antisense: AGAACTCATGGAGCCCAGTCA
Angiotensin-converting enzyme (ACE) Sense: CTGCCTCCCAACGAGTTAGAA
Antisense: CGGGACGTGGCCATTATATT
Angiotensin II type I receptor (AT1R) Sense: TATCACAGTGTGCGCGTTTCA
Antisense: TGGTAAGGCCCAGCCCTAT
Renin Sense: GCTACATGGAGAATGGGACTGAA
Antisense: ACCACATCTTGGCTGAGGAAAC
Reference gene: elongation factor-1 (Ef-1) Sense: GCAAGCCCATGTGTGTTGAA
Antisense: TGATGACACCCACAGCAACTG