Skip to main content

Table 1 Primers used for real-time PCR

From: Effects of fasting on the expression pattern of FGFs in different skeletal muscle fibre types and sexes in mice

PairsGenesPrimer sequence
1Mouse Fgf1 5′CCCTGACCGAGAGGTTCAAC
Mouse Fgf1 3′GTCCCTTGTCCCATCCACG
2Mouse Fgf2 5′GCGACCCACACGTCAAACTA
Mouse Fgf2 3′TCCCTTGATAGACACAACTCCTC
3Mouse Fgf3 5′TACAACGCAGAGTGTGAGTTTG
Mouse Fgf3 3′CACCGACACGTACCAAGGTC
4Mouse Fgf4 5′TACCCCGGTATGTTCATGGC
Mouse Fgf4 3′TTACCTTCATGGTAGGCGACA
5Mouse Fgf5 5′AAGTAGCGCGACGTTTTCTTC
Mouse Fgf5 3′CTGGAAACTGCTATGTTCCGAG
6Mouse Fgf6 5′CAGGCTCTCGTCTTCTTAGGC
Mouse Fgf6 3′AATAGCCGCTTTCCCAATTCA
7Mouse Fgf7 5′CTCTACAGATCATGCTTCCACC
Mouse Fgf7 3′ACAGAACAGTCTTCTCACCCT
8Mouse Fgf8 5′AGAGCCTGGTGACGGATCA
Mouse Fgf8 3′CTTCCAAAAGTATCGGTCTCCAC
9Mouse Fgf9 5′ATGGCTCCCTTAGGTGAAGTT
Mouse Fgf9 3′TCCGCCTGAGAATCCCCTTT
10Mouse Fgf10 5′TTTGGTGTCTTCGTTCCCTGT
Mouse Fgf10 3′TAGCTCCGCACATGCCTTC
11Mouse Fgf11 5′TAGCCTGATCCGACAGAAGC
Mouse Fgf11 3′GGCAGAACAGTTTGGTGACG
12Mouse Fgf12 5′CAGGCCGTGCATGGTTTCTA
Mouse Fgf12 3′TCGTGTAGTGATGGTTCTCTGT
13Mouse Fgf13 5′CTCATCCGGCAAAAGAGACAA
Mouse Fgf13 3′TTGGAGCCAAAGAGTTTGACC
14Mouse Fgf14 5′CCCCAGCTCAAGGGCATAG
Mouse Fgf14 3′TGATGGGTAGAGGTAACCTTCTC
15Mouse Fgf15 5′ATGGCGAGAAAGTGGAACGG
Mouse Fgf15 3′CTGACACAGACTGGGATTGCT
16Mouse Fgf16 5′GTGTTTTCCGGGAACAGTTTGA
Mouse Fgf16 3′GGTGAGCCGTCTTTATTCAGG
17Mouse Fgf17 5′GGCAGAGAGCGAGAAGTACAT
Mouse Fgf17 3′CGGTGAACACGCAGTCTTTG
18Mouse Fgf18 5′CCTGCACTTGCCTGTGTTTAC
Mouse Fgf18 3′TGCTTCCGACTCACATCATCT
19Mouse Fgf20 5′GGTGGGGTCGCACTTCTTG
Mouse Fgf20 3′GATACCGAAGAGACTGTGATCCT
20Mouse Fgf21 5′CTGCTGGGGGTCTACCAAG
Mouse Fgf21 3′CTGCGCCTACCACTGTTCC
21Mouse Fgf22 5′CCAGGACAGTATAGTGGAGATCC
Mouse Fgf22 3′AGTAGACCCGCGACCCATAG
22Mouse Fgf23 5′ATGCTAGGGACCTGCCTTAGA
Mouse Fgf23 3′AGCCAAGCAATGGGGAAGTG
23Mouse Flrt2 5′ATGGGCCTACAGACTACAAAGT
Mouse Flrt2 3′CAGCGGCATACACTAGGGC
24Mouse Flrt3 5′CCTCATCGGGACTAAAATTGGG
Mouse Flrt3 3′GCAAGTTCTTCAAATCGGAAGGA
25Mouse Tbp 5′ACCCTTCACCAATGACTCCTATG
Mouse Tbp 3′ATGATGACTGCAGCAAATCGC