Skip to main content

Table 2 rhAMP-SNP-assay sequences. Each rhAMP-assay consists of a set of allele-specific primers to distinguish between both alleles as well as a locus-specific primer common to both allelic variants. 5-prime modifications to each allele-specific primer regarding FAM/VIC-based fluorescence detection and 3-prime “blocking” immediately downstream of the given ribonucleotide remain subject to the vendor’s discretion (IDT)

From: Novel human sex-typing strategies based on the autism candidate gene NLGN4X and its male-specific gametologue NLGN4Y

Assay nameAllele-specific primer 1Allele-specific primer 2Locus-specific primer
SNP_ACCCCGAGCCAAAGATGCCCCCGAGCCAAAGATAGCGGATTGAGGAGAATGTGGGA
SNP_BATTCAGAGCGGCACCCATTCAGAGCGGCACTGCGACCTTGTCTGCCAATATCC
SNP_CAGAGAAACACCACAAATGATATCGCAGAGAAACACCACAAATGATATCAGCATCGTGTTCCAGCTGCTT