Skip to main content

Table 1 Oligonucleotides used for quantitative RT-PCR. Official gene symbols, NCBI accession number of targeted transcripts, and forward and reverse oligonucleotide sequences are depicted

From: Sexual dimorphism in PAR2-dependent regulation of primitive colonic cells

Genes NCBI accession number Forward
Reverse
F2rl1 (PAR2) NM_007974.4 GGACCGAGAACCTTGCAC
GAACCCCTTTCCCAGTGATT
F2r (PAR1) NM_010169.4 CAGCCAGAATCAGAGAGGACAGA
TGTATTTTCACTGGGATTCCTTAGAA
Ctnnb1 NM_007614.3
NM_001165902.1
GCTATTCCACGACTAGTTCAG
GGAATGGTATTGAGTCCTCG
Adam10 NM_007399.4 GAAGATGGTGTTGCCGACAG
TTTCCATACTGACCTCCCAGC
Cd44 NM_009851.2
NM_001039150.1
NM_001177785.1
NM_001177786.1
NM_001177787.1
TCTGCCATCTAGCACTAAGAGC
GTCTGGGTATTGAAAGGTGTA
Cd24a NM_009846.2 GGCACTGCTCCTACCCACGC
CACCCCCTCTGGTGGTAGCG
Dclk1 NM_019978 CTGCAGCAGGAGTTTCTGTA
CCGAGTTCAATTCCGGTGGA
Myc NM_010849.4
NM_001177353.1
AGTGCTGCATGAGGAGACAC
GCCTCTTCTCCACAGACACC
Ccnd1 NM_007631.2 TGCGTGAGAAGGAGATTGT
CTTCGCACTTCTGCTCCTCA
Rhob NM_007483 TGACTTGGGGTCGAGAGGAA
AAAAGTGACCCCACTGCACA
Mapk3 NM_011952.2 CACTGGCTTTCTGACGGAGT
GGATTTGGTGTAGCCCTTGGA
Sox9 NM_011448 GAGCCGGATCTGAAGAGGGA
GCTTGACGTGTGGCTTGTTC
Timp1 NM_001044384.1
NM_011593.2
NM_001294280.2
GAGCCCTGCTCAGCAAAGAG
GGACCTGATCCGTCCACAAAC
Itga3 NM_013565.3
NM_001306162.1
GATTCCTGGTGGTGAAGGAGG
GGGACACAGGTACACAGCAC
Dusp6 NM_026268.3 CAAGCAAATTCCTATCTCGG
GTCGTAAGCATCGTTCATG
Itga6 NM_008397.4
NM_001277970.1
CTCCCTCTCAGACTCGGTCA
CTGGCGGAGGTCAATTCTGT
Timp2 NM_011594.3 CAACAGGCGTTTTGCAATGC
ATCCTCTTGATGGGGTTGCC
Gsk3b NM_019827.7
NM_001347232.1
TGGTGCTGGACTATGTTC
GTTCTGTGGTTTAATGTCTCG
Hprt1 NM_013556 TCAGTCAACGGGGGACATAAA
GGGGCTGTACTGCTTAACCAG
Gapdh NM_001289726 AGGTCGGTGTGAACGGATTTG
TGTAGACCATGTAGTTGAGGTCA