Skip to main content

Advertisement

Table 1 Primers’ sequences used in quantitative RT-PCR

From: Corticotropin-releasing factor overexpression in mice abrogates sex differences in body weight, visceral fat, and food intake response to a fast and alters levels of feeding regulatory hormones

Name   Accession number
NPY Forward: 5′-AGAGATCCAGCCCTGAGACA Reverse: 5′-TTTCATTTCCCATCACCACA NM_023456
POMC Forward: 5′- GGCTTGCAAACTCGACCTCT Reverse: 5′- TGACCCATGACGTACTTCCG NM_008895
Leptin receptor Forward: 5′-CAGAATGACGCAGGGCTGTA Reverse: 5′- TCTGAAATGGGTTCAGGCTCC NM_146146.2
CRF2 receptor Forward: 5′-CAGTCCTTCCAGGGTTTCTTTG Reverse: 5′- GGTCACACAGCAGCTGTCTGCTT AY445512
S16 Forward: 5′-TGCGGTGTGGAGCTCGTGCTTGT Reverse: 5′-GCTACCAGGCCTTTGAGATGGA GenBank M11408