Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers’ sequences used in quantitative RT-PCR

From: Corticotropin-releasing factor overexpression in mice abrogates sex differences in body weight, visceral fat, and food intake response to a fast and alters levels of feeding regulatory hormones

Name   Accession number
NPY Forward: 5′-AGAGATCCAGCCCTGAGACA
Reverse: 5′-TTTCATTTCCCATCACCACA
NM_023456
POMC Forward: 5′- GGCTTGCAAACTCGACCTCT
Reverse: 5′- TGACCCATGACGTACTTCCG
NM_008895
Leptin receptor Forward: 5′-CAGAATGACGCAGGGCTGTA
Reverse: 5′- TCTGAAATGGGTTCAGGCTCC
NM_146146.2
CRF2 receptor Forward: 5′-CAGTCCTTCCAGGGTTTCTTTG
Reverse: 5′- GGTCACACAGCAGCTGTCTGCTT
AY445512
S16 Forward: 5′-TGCGGTGTGGAGCTCGTGCTTGT
Reverse: 5′-GCTACCAGGCCTTTGAGATGGA
GenBank M11408