Skip to main content

Table 1 Primer sequences

From: Removal of reproductive suppression reveals latent sex differences in brain steroid hormone receptors in naked mole-rats, Heterocephalus glaber

Gene Primers
Androgen receptor (Ar) Forward: CTGGAAGTGGCCTCAGAAAG
Reverse: GCGCTGTCAGATATGGTTGA
Estrogen receptor alpha (Esr1) Forward: GAGGACTTGGTCCTGGATGA
Reverse: CCAGGGCCTTCAGTAAGACA
Progesterone receptor (Pgr) Forward: CAGTTGGTCCCTCCACTGAT
Reverse: TGCCTCTCGCCTAGTTGATT
Aromatase (Cyp19a1) Forward: TCGTCCTGGTGACACTTCTG
Reverse: GGCAGGTCATCCATCTCATT
Glyceraldehyde 3′ phosphate dehydrogenase (GAPDH) Forward: CCAAGGTCATCCACGACAAT
Reverse: ACGCTGGGATGATGTTCTG