Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in RT-PCR experiments

From: Sex differences in porcine left ventricular myocardial remodeling due to right ventricular pacing

Gene Sequence 5′-3′ GenBank accession no.
GAPDH TCACTGCCACCCAGAAGA TACCAGGAAATGAGCTTGAC ABO38240
BNP GATACAGGAGCTGCTGGAC GAGGACTTGGAAGATGCTACTGC M23596
GATA4 CAGCAGCAGCGAAGAGATG CGAGAGGACCGGGTGGATGG AY115491
TGF-β1 CTACTACGCCAAGGAGGTCAC GCCCGAGAGAGCAATACAGG X12373
MMP9 CCACAGGCCCTCCTTCAG TGAACAGCAGCACCTTACC NM001038004
NGAL TTAAGAAATACTCTGGATTGC TACTCTTGGTTGTTGGAAAC AK240091
TIMP1 AGCCAGGAGTTTCTCATAGC TCACAGCCAGCAGCATAG NM213857
Col1A1 AGCGGAGAATACTGGATTGAC CGTGCCTCTTGTCCTTGG AF201723
Col1A2 ATGCCGTGACTTGAGACTC CCTTGGTGGTAACTCCTTCC AB237775
Col3A1 CGGACAAATAGAAAGCCTCATTAG GAAGTTCAGGATTGCCATAGC DT322297
  1. GAPDH glyceraldehyde-3-phosphate dehydrogenase, BNP B-type natriuretic peptide, GATA4 GATA binding protein type 4, TGF-β1 transforming growth factor β1, MMP9 matrix metalloproteinase type 9, NGAL neutrophil gelatinase-associated lipocalin, TIMP1 tissue inhibitor of metalloproteinases type 1, Col1A1 collagen type 1 α1, Col1A2 collagen type I α2, Col3A1 collagen type III α1