Skip to main content

Table 1 Nucleotide sequence of primers and oligonucleotides used in the experiments

From: Interference of kallikrein 1b26 (klk1b26) translation by microRNA specifically expressed in female mouse submandibular glands: an additional mechanism for sexual dimorphism of klk1b26 protein in the glands

Name of primers/oligonucleotides Sequence (5'-3') Corresponding position on klk1b26 mRNA (NM 010644)
DNA:   
F1 (forward primer) agctccaagctcactgcctg 1-20
F11 (forward primer) tcactgcctgcagttcctg 11-30
F15 (forward primer) tgcctgcagttcctggacac 15-34
F21 (forward primer) cagttcctggacacctgtta 21-40
F24 (forward primer) ttcctggacacctgttacc 24-42
F40 (forward primer) accatgtggttcctgatcct 40-59
F100 (forward primer) cctctccagtctcgggtggt 100-119
F169 (forward primer) tactaccaaaaggaacacattt 169-190
R552 (reverse primer) atcatctgacttttgccatc 533-552 (complementary)
R609 (reverse primer) taggtagactttggcacagtctc 586-609 (complementary)
[15th-44th]ssDNA tgcctgcagttcctggacacctgttaccat 15-44
[169th-198th]ssDNA tactaccaaaaggaacacatttgtgggggt 169-198
RNA:   
hsa-miR-325 ccuaguagguguccaguaagugu 21-40 (partly complementary)
miR-1497a uugaagaacugcaggugguggau 12-28 (partly complementary)
asR-F21 uaacagguguccaggaacug 21-40 (complementary)
  1. klk1b26 = kallikrein 1b26; ssDNA = single-stranded DNA.