Table 1 Nucleotide sequence of primers and oligonucleotides used in the experiments
Name of primers/oligonucleotides | Sequence (5'-3') | Corresponding position on klk1b26 mRNA (NM 010644) |
|---|---|---|
DNA: | Â | Â |
F1 (forward primer) | agctccaagctcactgcctg | 1-20 |
F11 (forward primer) | tcactgcctgcagttcctg | 11-30 |
F15 (forward primer) | tgcctgcagttcctggacac | 15-34 |
F21 (forward primer) | cagttcctggacacctgtta | 21-40 |
F24 (forward primer) | ttcctggacacctgttacc | 24-42 |
F40 (forward primer) | accatgtggttcctgatcct | 40-59 |
F100 (forward primer) | cctctccagtctcgggtggt | 100-119 |
F169 (forward primer) | tactaccaaaaggaacacattt | 169-190 |
R552 (reverse primer) | atcatctgacttttgccatc | 533-552 (complementary) |
R609 (reverse primer) | taggtagactttggcacagtctc | 586-609 (complementary) |
[15th-44th]ssDNA | tgcctgcagttcctggacacctgttaccat | 15-44 |
[169th-198th]ssDNA | tactaccaaaaggaacacatttgtgggggt | 169-198 |
RNA: | Â | Â |
hsa-miR-325 | ccuaguagguguccaguaagugu | 21-40 (partly complementary) |
miR-1497a | uugaagaacugcaggugguggau | 12-28 (partly complementary) |
asR-F21 | uaacagguguccaggaacug | 21-40 (complementary) |